DN617285

Overview
NameDN617285
Unique NameDN617285
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length424
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2000 contig Csv1_Contig2000:21..444. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS11_01A02_r Parent Washington Navel Orange Scale-Infested Rind cDNA Library UCRCS11 Citrus sinensis cDNA clone CS_WEd0001A02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DN617285 ID=DN617285|Name=DN617285|organism=Citrus sinensis|type=EST|length=424bp
TTAAAATTCATTCTGAAACACTAAAACTAAATAATCGAATATGGGTTTGC
GGGTCAATGATGCCAGAAGCAATGAGAGTGCAATTATCACTTGTTTAGTT
TCTGTGCTTGCCGTGGTTTACTTCGCATGGAATGTGAAAAAATCAAGGAA
AGCAAATGCTAAACTTCCACCAGGACCTCGCGGCTTGCCTGTAGTCGGAT
ACCTCCCATTTCTCGGAACTACTGACTTGCACAAGAAATTCACGGAATTA
TCCGGAGTTTATGGTCCGATCTTCAAGCTCTGGCTCGGAAATAAATTATG
TGTAGTGGTGAGCTCACCTTCCCTAGTTAAACAAGTGGTTCGTGATCAAG
ATACAACATTCGCATACCGTGACCCGCCGATCGCTGGACTAGTGGCCACC
TTTGGTGGCAATGATATTGCATGG
back to top