DN135276

Overview
NameDN135276
Unique NameDN135276
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length650
Libraries
Library NameType
Mature Juice Sac from Navel Orange in Vulnus5 vectorcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
DN135276_ssr227 microsatellite DN135276_ssr227:227..238. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig5706 contig Csv1_Contig5706:1..652. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionwca08h09 Mature Juice Sac from Navel Orange in Vulnus5 vector Citrus sinensis cDNA clone wca08h09 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DN135276 ID=DN135276|Name=DN135276|organism=Citrus sinensis|type=EST|length=650bp
GCTAAAAAAGCACTTATGAGAACTCTTCTTTCTTCCCAAACCCGCTTCTG
CTTTTCAAAAGCCTTCAGTATGGAATCTCAGAAGCTCTTTTACCCACCCC
ACAACCCAGCAAAGCCTAACAAGCCATCCCACCACATCATGGAAACTTCA
TGCCAATGCAAAAGGGTTTGGAGCCAGAAACACTTCACCACCAGCTAGCT
TAAACAAGAGTGCTTCTGACGACGAGAACAACAACAACAATAACAGTGAT
GAGGATCATCTTCCACAGGTGGTATTGGAGAGAATCATAGTGAGAATCTT
GGTCTCTGTTGAGGTTCCATTGGCCACCGGCATAGCTTCCTTGCATTTCT
TTGGTGTTGTGAAGGAAAAGCAGCTCTTTGATTTGCCACTTTGGATTCCA
TTGGTAACAACTTTCCTGACTTTTGGACTATCTGCTGTTGGAATTGCTTA
TGGGTCACTTTCTAGTAGCTGGGATGCAGAGAAGCAAGGTTCATTGCTTG
GATTTGAGGAAGCTAAGCAGAATTGGGTTGAGATTTGGAATGAAGATGAC
GGTTAAAATGAAGACATTTAGGATACATTATTTCAAATGATCCAATGAGC
AATTTCGGACATTGTATAGNGAGCAGCANNNCACCATTACTTATTACATA
back to top