DN135274

Overview
NameDN135274
Unique NameDN135274
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length701
Libraries
Library NameType
Mature Juice Sac from Navel Orange in Vulnus5 vectorcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig13572 contig Csv1_Contig13572:1203..1903. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Homology
BLAST of DN135274 vs. ExPASy Swiss-Prot
Match: SYTM_ARATH (Threonyl-tRNA synthetase, mitochondrial OS=Arabidopsis thaliana GN=THRRS PE=2 SV=3)

HSP 1 Score: 382.489 bits (981), Expect = 1.186e-105
Identity = 183/227 (80.62%), Postives = 202/227 (88.99%), Query Frame = 2
Query:   20 KVRSYRELPLRLADFGVLHRNEASGALTGLTRVRRFQQDDAHIFCRESQIKDEVRGVLEFIDYAYRIFGFTYELKLSTRPEKYLGDLATWEKAEAALTEALNEFGKPWQINEGDGAFYGPKIDISVSDALKRKFQCATLQLDFQLPDRFNLGYSAEDEAKTERPVMIHRAILGSVERMFAILLEHYKGKWPFWLSPRQAIVCPVSXXSQPYALQVRDHIYRAGYYVD 700
            +VRSYRELP+RLADFGVLHRNEASGAL+GLTRVRRFQQDDAHIFC   Q+K EV+GVLEFIDY Y++FGFTYELKLSTRPEKYLGDL TW+KAEA L EA+  FGKP  +NEGDGAFYGPKIDI+VSDA+ RKFQCATLQLDFQLP RFNL Y+AEDEAK  RPVMIHRA+LGSVERMFAILLEHYKGKWPFW+SPRQAIVCP+S  SQ YA +V+  I  AG+YVD
Sbjct:  417 RVRSYRELPMRLADFGVLHRNEASGALSGLTRVRRFQQDDAHIFCTTEQVKGEVQGVLEFIDYVYKVFGFTYELKLSTRPEKYLGDLETWDKAEADLKEAIEAFGKPLVLNEGDGAFYGPKIDITVSDAMNRKFQCATLQLDFQLPIRFNLEYAAEDEAKKSRPVMIHRAVLGSVERMFAILLEHYKGKWPFWISPRQAIVCPISEKSQQYAEKVQKQIKDAGFYVD 643          
BLAST of DN135274 vs. ExPASy Swiss-Prot
Match: SYTC_ARATH (Probable threonyl-tRNA synthetase, cytoplasmic OS=Arabidopsis thaliana GN=At1g17960 PE=2 SV=2)

HSP 1 Score: 323.168 bits (827), Expect = 8.540e-88
Identity = 156/221 (70.59%), Postives = 181/221 (81.90%), Query Frame = 2
Query:   38 ELPLRLADFGVLHRNEASGALTGLTRVRRFQQDDAHIFCRESQIKDEVRGVLEFIDYAYRIFGFTYELKLSTRPEKYLGDLATWEKAEAALTEALNEFGKPWQINEGDGAFYGPKIDISVSDALKRKFQCATLQLDFQLPDRFNLGYSAEDEAKTERPVMIHRAILGSVERMFAILLEHYKGKWPFWLSPRQAIVCPVSXXSQPYALQVRDHIYRAGYYVD 700
            +LP+R+A+FGVLHRNE SGAL G+TRVRRF QDDAHIFCR  Q+++EV+GVL+FIDY YRIFGFTYEL LSTRP+ ++GDL TW KAE  L +AL++FGKPW I EGDGAFYGPKIDI+VSDA  RKFQCAT+QLDFQLP  F L Y +E + + E PVMIH A+LGS+ERMFAILLEHYKG WPFWLSPRQAIVC +S     YA QV+  I   GYYVD
Sbjct:  169 KLPIRMAEFGVLHRNEDSGALGGMTRVRRFVQDDAHIFCRVDQVEEEVKGVLDFIDYVYRIFGFTYELTLSTRPKDHIGDLETWAKAENDLEKALDDFGKPWVIKEGDGAFYGPKIDITVSDARNRKFQCATIQLDFQLPACFKLKYLSE-KNEMEAPVMIHSAVLGSIERMFAILLEHYKGIWPFWLSPRQAIVCSLSEDCSSYAKQVQKQINEVGYYVD 388          
BLAST of DN135274 vs. ExPASy Swiss-Prot
Match: SYTC_RAT (Threonyl-tRNA synthetase, cytoplasmic OS=Rattus norvegicus GN=Tars PE=2 SV=1)

HSP 1 Score: 308.916 bits (790), Expect = 1.667e-83
Identity = 146/225 (64.89%), Postives = 175/225 (77.78%), Query Frame = 2
Query:   26 RSYRELPLRLADFGVLHRNEASGALTGLTRVRRFQQDDAHIFCRESQIKDEVRGVLEFIDYAYRIFGFTYELKLSTRPEKYLGDLATWEKAEAALTEALNEFGKPWQINEGDGAFYGPKIDISVSDALKRKFQCATLQLDFQLPDRFNLGYSAEDEAKTERPVMIHRAILGSVERMFAILLEHYKGKWPFWLSPRQAIVCPVSXXSQPYALQVRDHIYRAGYYVD 700
            RS+RELPLRLADFGVLHRNE SGALTGLTRVRRFQQDDAHIFC   QI+DE++G L+F+   Y +FGF+++L LSTRPEK+LGD+  W +AE  L  +LNEFG+ W++N GDGAFYGPKIDI + DA+ R  QCAT+QLDFQLP RFNL Y + D    +RPV++HRAILGSVERM AIL E+Y GKWPFWLSPRQ +V PV      YA +VR   + A + VD
Sbjct:  397 RSWRELPLRLADFGVLHRNELSGALTGLTRVRRFQQDDAHIFCAMEQIEDEIKGCLDFLRTVYSVFGFSFKLNLSTRPEKFLGDIEIWNQAEKQLENSLNEFGEKWELNPGDGAFYGPKIDIQIKDAIGRYHQCATIQLDFQLPIRFNLTYVSHDGDDKKRPVIVHRAILGSVERMIAILTENYGGKWPFWLSPRQVMVVPVGPTCDEYAQKVRQEFHDAKFMVD 621          
BLAST of DN135274 vs. ExPASy Swiss-Prot
Match: SYTC_HUMAN (Threonyl-tRNA synthetase, cytoplasmic OS=Homo sapiens GN=TARS PE=1 SV=3)

HSP 1 Score: 308.916 bits (790), Expect = 1.667e-83
Identity = 145/225 (64.44%), Postives = 175/225 (77.78%), Query Frame = 2
Query:   26 RSYRELPLRLADFGVLHRNEASGALTGLTRVRRFQQDDAHIFCRESQIKDEVRGVLEFIDYAYRIFGFTYELKLSTRPEKYLGDLATWEKAEAALTEALNEFGKPWQINEGDGAFYGPKIDISVSDALKRKFQCATLQLDFQLPDRFNLGYSAEDEAKTERPVMIHRAILGSVERMFAILLEHYKGKWPFWLSPRQAIVCPVSXXSQPYALQVRDHIYRAGYYVD 700
            RS+RELPLRLADFGVLHRNE SGALTGLTRVRRFQQDDAHIFC   QI+DE++G L+F+   Y +FGF+++L LSTRPEK+LGD+  W++AE  L  +LNEFG+ W++N GDGAFYGPKIDI + DA+ R  QCAT+QLDFQLP RFNL Y + D    +RPV++HRAILGSVERM AIL E+Y GKWPFWLSPRQ +V PV      YA +VR   + A +  D
Sbjct:  425 RSWRELPLRLADFGVLHRNELSGALTGLTRVRRFQQDDAHIFCAMEQIEDEIKGCLDFLRTVYSVFGFSFKLNLSTRPEKFLGDIEVWDQAEKQLENSLNEFGEKWELNSGDGAFYGPKIDIQIKDAIGRYHQCATIQLDFQLPIRFNLTYVSHDGDDKKRPVIVHRAILGSVERMIAILTENYGGKWPFWLSPRQVMVVPVGPTCDEYAQKVRQQFHDAKFMAD 649          
BLAST of DN135274 vs. ExPASy Swiss-Prot
Match: SYTC_MOUSE (Threonyl-tRNA synthetase, cytoplasmic OS=Mus musculus GN=Tars PE=1 SV=2)

HSP 1 Score: 307.375 bits (786), Expect = 4.849e-83
Identity = 145/225 (64.44%), Postives = 174/225 (77.33%), Query Frame = 2
Query:   26 RSYRELPLRLADFGVLHRNEASGALTGLTRVRRFQQDDAHIFCRESQIKDEVRGVLEFIDYAYRIFGFTYELKLSTRPEKYLGDLATWEKAEAALTEALNEFGKPWQINEGDGAFYGPKIDISVSDALKRKFQCATLQLDFQLPDRFNLGYSAEDEAKTERPVMIHRAILGSVERMFAILLEHYKGKWPFWLSPRQAIVCPVSXXSQPYALQVRDHIYRAGYYVD 700
            RS+RELPLRLADFGVLHRNE SGALTGLTRVRRFQQDDAHIFC   QI+DE++G L+F+   Y +FGF+++L LSTRPEK+LGD+  W +AE  L  +LNEFG+ W++N GDGAFYGPKIDI + DA+ R  QCAT+QLDFQLP RFNL Y + D    +RPV++HRAILGSVERM AIL E+Y GKWPFWLSPRQ +V PV      YA +VR   + A +  D
Sbjct:  424 RSWRELPLRLADFGVLHRNELSGALTGLTRVRRFQQDDAHIFCAMEQIEDEIKGCLDFLRTVYSVFGFSFKLNLSTRPEKFLGDIEIWNQAEKQLENSLNEFGEKWELNPGDGAFYGPKIDIQIKDAIGRYHQCATIQLDFQLPIRFNLTYVSHDGDDKKRPVIVHRAILGSVERMIAILTENYGGKWPFWLSPRQVMVVPVGPTCDEYAQKVRQQFHDAKFMAD 648          
BLAST of DN135274 vs. ExPASy Swiss-Prot
Match: SYTC_YEAST (Threonyl-tRNA synthetase, cytoplasmic OS=Saccharomyces cerevisiae GN=THS1 PE=1 SV=2)

HSP 1 Score: 306.22 bits (783), Expect = 1.080e-82
Identity = 144/227 (63.44%), Postives = 177/227 (77.97%), Query Frame = 2
Query:   26 RSYRELPLRLADFGVLHRNEASGALTGLTRVRRFQQDDAHIFCRESQIKDEVRGVLEFIDYAYRIFGFTYELKLSTRPEKYLGDLATWEKAEAALTEALNEFGKPWQINEGDGAFYGPKIDISVSDALKRKFQCATLQLDFQLPDRFNLGYSAEDE--AKTERPVMIHRAILGSVERMFAILLEHYKGKWPFWLSPRQAIVCPVSXXSQPYALQVRDHIYRAGYYVD 700
            RSYRELP R+ADFGV+HRNE SGAL+GLTRVRRFQQDDAHIFC   QI+ E+  +  F+ Y Y +FGF ++++LSTRPEKY+G + TW+ AE+ L  AL ++G  W+IN GDGAFYGPKIDI +SDAL+R  QCAT+QLDFQLP+RF L + ++D+     ERPVMIHRAILGSVERM AIL EH+ GKWPFWLSPRQ +V PV    Q YA  VR+ ++ AG+Y D
Sbjct:  432 RSYRELPWRVADFGVIHRNEFSGALSGLTRVRRFQQDDAHIFCTHDQIESEIENIFNFLQYIYGVFGFEFKMELSTRPEKYVGKIETWDAAESKLESALKKWGGNWEINAGDGAFYGPKIDIMISDALRRWHQCATIQLDFQLPNRFELEFKSKDQDSESYERPVMIHRAILGSVERMTAILTEHFAGKWPFWLSPRQVLVVPVGVKYQGYAEDVRNKLHDAGFYAD 658          
BLAST of DN135274 vs. ExPASy Swiss-Prot
Match: SYTC_BOVIN (Threonyl-tRNA synthetase, cytoplasmic OS=Bos taurus GN=TARS PE=2 SV=1)

HSP 1 Score: 305.834 bits (782), Expect = 1.411e-82
Identity = 144/225 (64.00%), Postives = 175/225 (77.78%), Query Frame = 2
Query:   26 RSYRELPLRLADFGVLHRNEASGALTGLTRVRRFQQDDAHIFCRESQIKDEVRGVLEFIDYAYRIFGFTYELKLSTRPEKYLGDLATWEKAEAALTEALNEFGKPWQINEGDGAFYGPKIDISVSDALKRKFQCATLQLDFQLPDRFNLGYSAEDEAKTERPVMIHRAILGSVERMFAILLEHYKGKWPFWLSPRQAIVCPVSXXSQPYALQVRDHIYRAGYYVD 700
            RS+RELPLR+ADFGVLHRNE SGALTGLTRVRRFQQDDAHIFC   QI+DE++G L+F+   Y IFGF+++L LSTRPEK+LGD+  W +AE  L  +LN+FG+ W++N GDGAFYGPKIDI + DA+ R  QCAT+QLDFQLP RFNL + + D    ++PV+IHRAILGSVERM AIL E+Y GKWPFWLSPRQ +V PV      YA +VR   + A + VD
Sbjct:  425 RSWRELPLRVADFGVLHRNELSGALTGLTRVRRFQQDDAHIFCAMEQIEDEIKGCLDFLRTVYSIFGFSFKLNLSTRPEKFLGDIEVWNQAEKQLENSLNDFGEKWELNPGDGAFYGPKIDIQIKDAIGRYHQCATIQLDFQLPIRFNLTFVSHDGDDKKKPVIIHRAILGSVERMIAILTENYGGKWPFWLSPRQVMVVPVGPTCDEYAQKVRQQFHNAKFMVD 649          
BLAST of DN135274 vs. ExPASy Swiss-Prot
Match: SYTC2_XENTR (Probable threonyl-tRNA synthetase 2, cytoplasmic OS=Xenopus tropicalis GN=tarsl2 PE=2 SV=1)

HSP 1 Score: 305.064 bits (780), Expect = 2.407e-82
Identity = 142/225 (63.11%), Postives = 174/225 (77.33%), Query Frame = 2
Query:   26 RSYRELPLRLADFGVLHRNEASGALTGLTRVRRFQQDDAHIFCRESQIKDEVRGVLEFIDYAYRIFGFTYELKLSTRPEKYLGDLATWEKAEAALTEALNEFGKPWQINEGDGAFYGPKIDISVSDALKRKFQCATLQLDFQLPDRFNLGYSAEDEAKTERPVMIHRAILGSVERMFAILLEHYKGKWPFWLSPRQAIVCPVSXXSQPYALQVRDHIYRAGYYVD 700
            RS+RELPLR ADFGVLHRNE SG L+GLTRVRRFQQDDAHIFC   QI++E+ G L+F+   Y++FGFT++L LSTRPE YLG++  W +AE  L  +LN+FG+PW++N GDGAFYGPKIDI + DA+ R  QCAT+QLDFQLP RFNL Y ++D    +RPV+IHRAILGSVERM AIL E+Y GKWPFWLSPRQ +V PV      YA QV   ++ AG+  +
Sbjct:  516 RSWRELPLRFADFGVLHRNELSGTLSGLTRVRRFQQDDAHIFCTMDQIQEEMNGCLQFLQSVYKVFGFTFQLHLSTRPENYLGEIEIWNEAEKQLESSLNQFGEPWKLNPGDGAFYGPKIDIKIKDAIGRYHQCATIQLDFQLPIRFNLTYVSKDGDDKKRPVIIHRAILGSVERMIAILCENYGGKWPFWLSPRQVMVIPVGPSCDEYAQQVCKDVFEAGFMAE 740          
BLAST of DN135274 vs. ExPASy Swiss-Prot
Match: SYTC_CAEEL (Threonyl-tRNA synthetase, cytoplasmic OS=Caenorhabditis elegans GN=trs-1 PE=2 SV=1)

HSP 1 Score: 303.908 bits (777), Expect = 5.362e-82
Identity = 143/225 (63.56%), Postives = 180/225 (80.00%), Query Frame = 2
Query:   29 SYRELPLRLADFGVLHRNEASGALTGLTRVRRFQQDDAHIFCRESQIKDEVRGVLEFIDYAY-RIFGFTYELKLSTRPEKYLGDLATWEKAEAALTEALNEFGKPWQINEGDGAFYGPKIDISVSDALKRKFQCATLQLDFQLPDRFNLGYSAEDEAKTERPVMIHRAILGSVERMFAILLEHYKGKWPFWLSPRQAIVCPVSXXSQPYALQVRDHIYRAGYYVD 700
            +Y ELP R ADFGVLHRNE SGALTGLTRVRRFQQDDAHIFCR+ QI +E++  L+F++YAY ++FGFT++L LSTRPE +LG++ TW+KAEA LT ALN  G+ W +N GDGAFYGPKIDI++ DALKR FQCAT+QLDFQLP++F+L Y  +++ + +RPVMIHRA+LGSVERM AIL E Y GKWPFWLSPRQ  +  V    + YA  V+  I+ AG+ ++
Sbjct:  425 TYNELPFRFADFGVLHRNEMSGALTGLTRVRRFQQDDAHIFCRQDQISEEIKQCLDFLEYAYEKVFGFTFKLNLSTRPEGFLGNIETWDKAEADLTNALNASGRKWVLNPGDGAFYGPKIDITIQDALKRNFQCATIQLDFQLPNQFDLSY-FDEKGEKQRPVMIHRAVLGSVERMTAILTESYGGKWPFWLSPRQCKIITVHESVRDYANDVKKQIFEAGFEIE 648          
BLAST of DN135274 vs. ExPASy Swiss-Prot
Match: SYTC1_DICDI (Probable threonyl-tRNA synthetase 1, cytoplasmic OS=Dictyostelium discoideum GN=thrS1 PE=3 SV=1)

HSP 1 Score: 301.212 bits (770), Expect = 3.475e-81
Identity = 145/226 (64.16%), Postives = 176/226 (77.88%), Query Frame = 2
Query:   26 RSYRELPLRLADFGVLHRNEASGALTGLTRVRRFQQDDAHIFCRESQIKDEVRGVLEFIDYAYRIFGFTYELKLSTRPEKYLGDLATWEKAEAALTEALNEFGKPWQINEGDGAFYGPKIDISVSDALKRKFQCATLQLDFQLPDRFNLGYSAEDEAK-TERPVMIHRAILGSVERMFAILLEHYKGKWPFWLSPRQAIVCPVSXXSQPYALQVRDHIYRAGYYVD 700
            RSYRELPLR ADFGVLHRNE +GALTGLTRVR+FQQDDAHIFC    I+DE+   L F+ Y Y IFGF + L+LSTRP+ +LG++A W+ AEA+L +ALN+FGKPW++N  DGAFYGPKIDI ++D LKR  QCAT+QLDFQLP RF+L Y ++D A+  +RPV+IHRAILGSVERM AIL+EH  GKWP W+SPRQAIV  V+     Y  +V   I  AG+Y D
Sbjct:  419 RSYRELPLRFADFGVLHRNELAGALTGLTRVRKFQQDDAHIFCTTEMIEDEINSCLGFMQYVYGIFGFEFGLELSTRPDNFLGEIAQWDIAEASLEKALNKFGKPWKLNPKDGAFYGPKIDIHITDCLKRSHQCATIQLDFQLPIRFDLEYQSDDAAELKKRPVIIHRAILGSVERMMAILIEHTGGKWPLWVSPRQAIVVTVNKTHNEYGQKVCKEISDAGFYCD 644          
The following BLAST results are available for this feature:
BLAST of DN135274 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 500
Match NameE-valueIdentityDescription
SYTM_ARATH1.186e-10580.62Threonyl-tRNA synthetase, mitochondrial OS=Arabido... [more]
SYTC_ARATH8.540e-8870.59Probable threonyl-tRNA synthetase, cytoplasmic OS=... [more]
SYTC_RAT1.667e-8364.89Threonyl-tRNA synthetase, cytoplasmic OS=Rattus no... [more]
SYTC_HUMAN1.667e-8364.44Threonyl-tRNA synthetase, cytoplasmic OS=Homo sapi... [more]
SYTC_MOUSE4.849e-8364.44Threonyl-tRNA synthetase, cytoplasmic OS=Mus muscu... [more]
SYTC_YEAST1.080e-8263.44Threonyl-tRNA synthetase, cytoplasmic OS=Saccharom... [more]
SYTC_BOVIN1.411e-8264.00Threonyl-tRNA synthetase, cytoplasmic OS=Bos tauru... [more]
SYTC2_XENTR2.407e-8263.11Probable threonyl-tRNA synthetase 2, cytoplasmic O... [more]
SYTC_CAEEL5.362e-8263.56Threonyl-tRNA synthetase, cytoplasmic OS=Caenorhab... [more]
SYTC1_DICDI3.475e-8164.16Probable threonyl-tRNA synthetase 1, cytoplasmic O... [more]

Pages

back to top
Properties
Property NameValue
Genbank descriptionwca08h07 Mature Juice Sac from Navel Orange in Vulnus5 vector Citrus sinensis cDNA clone wca08h07 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DN135274 ID=DN135274|Name=DN135274|organism=Citrus sinensis|type=EST|length=701bp
TACGGCCGGGGTTTGNNNTAAGGTTCGTTCATACAGAGAACTACCTCTGC
GACTGGCTGATTTTGGGGTCTTGCATCGGAATGAAGCCAGTGGAGCACTC
ACTGGATTAACTCGTGTCAGGAGATTTCAGCAGGATGACGCTCATATTTT
CTGCAGGGAGTCCCAGATAAAAGACGAAGTAAGGGGTGTCCTAGAGTTCA
TTGATTATGCCTACAGAATATTCGGGTTCACATATGAGCTGAAGCTATCA
ACTAGGCCTGAAAAGTATCTTGGGGACTTGGCAACTTGGGAGAAAGCCGA
AGCTGCTCTTACAGAAGCATTGAATGAGTTTGGGAAGCCATGGCAGATAA
ATGAAGGGGATGGAGCATTTTATGGACCAAAGATTGATATCAGTGTATCT
GATGCATTGAAGAGGAAATTCCAGTGTGCTACTTTGCAGCTTGACTTTCA
GCTTCCTGATCGTTTCAACTTGGGTTACTCAGCGGAAGATGAAGCCAAGA
CAGAGAGACCTGTTATGATACACAGAGCGATATTGGGGTCTGTTGAACGT
ATGTTTGCTATACTGTTGGAACATTACAAGGGGAAGTGGCCTTTTTGGCT
CAGTCCACGTCAAGCAATTGTTTGCCCTGTGTCNNNGNAATCCCAACCAT
ATGCTTTACAGGTGCGGGATCATATTTATCGAGCCGGTTATTATGTTGAT
G
back to top