DN135238

Overview
NameDN135238
Unique NameDN135238
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length756
Libraries
Library NameType
Mature Juice Sac from Navel Orange in Vulnus5 vectorcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig1956 contig Csv1_Contig1956:257..1012. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionwca08c11 Mature Juice Sac from Navel Orange in Vulnus5 vector Citrus sinensis cDNA clone wca08c11 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DN135238 ID=DN135238|Name=DN135238|organism=Citrus sinensis|type=EST|length=756bp
TACGGCCGGGGATCCCGGATCCTGTAACGATGGCGACATCGAACGATAAA
TTGCAGAAGATGGAGCTCCGTCAAAATTACCAGAATCTATGGCACACTGA
TCTCATGCATACCGTGACTCAAGATCCTCCCTATTGCTGCTTTTCTTGTC
TCTGTGGACCATGTGTATCCTACTTGCTTCGGAAACGGGCGCTCTACAAT
GACATGTCCAGGTATGTTTGTTGTGCTGGTTATATGCCCTGTAGCGGCAA
GTGTGGAGAAAGTAAATGCCCTGAAATCTGCCTCGCCACTGAGGTTTTTT
GCTGCTTTGCCAATTCGGTGGCCTCTACGCGCTTTCTTTTGCAAGATGAA
TTTAACATCCAGACAACTGCCTGTGATAATTGCATCATTGGGTTTATGTT
TTGCCTCAGCCAACTTGCATGCATATTTTCCTTAGTTGCATGCATCGTGG
GAAGTGATGAACTTCAGGAGGCTTCACAGATACTGAATCTATTGGCTGAT
TTAGTTTATTGCACGGTCTGTGCCTGCATGCAGACACAGCACAAGGTTGA
AATGGATAAAAGGGATGGTAAATTTGGTCCACAACCAATGGCGGTACCCC
CACATCAACAGATGTCTCGCATTGATCAGCCATATCCTGCGACGGTTGGA
TATCCACCTCAACAACAAGCATATGGTTATCCTCCTCAAGGCTATCCACC
ACCTCANNNTCAGGGCTACCCACCACCCCAAGGTCAAGGCTATCCAGCTG
GAGGTT
back to top