DN135237

Overview
NameDN135237
Unique NameDN135237
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length468
Libraries
Library NameType
Mature Juice Sac from Navel Orange in Vulnus5 vectorcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2573 contig Csv1_Contig2573:442..909. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionwca08c10 Mature Juice Sac from Navel Orange in Vulnus5 vector Citrus sinensis cDNA clone wca08c10 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DN135237 ID=DN135237|Name=DN135237|organism=Citrus sinensis|type=EST|length=468bp
CGGCCGGGGGCAATAACTTGATTACTGAATCAATTCTTTGATTTCACATA
TAGTTCTTGCTTCTTGTTTTTCTTCAGCAATTAATATTAACACAGATGGG
GCAAATTAGCAGCTTAAAGTCAGTCGTGATGGTGTTCGTTTTGGCAGCTT
TTGCAATGGCTGCTGCTTCAGCTCAAAGCACCGAGATGGCCCCCGCACCA
TCTCCTTCATTGGACACCGGAGCAGCCTCTTCTCTGCCGGTTTCCGGTGC
TGTTATTGCATCTTCGCTGTTTGTTTCTCTTCTCGCTCTCCTGAAGCACT
AAGTCGTTTGGTAACGGAAGAAAACTATTACTAGGATATTATTTTCGAGG
GTGATTGGAGATTAATGTATTGAATTATTTATTTGTTCTTTTCATATTTC
ATACTATTAATGACATAATAATACTTATTCTTTCTGTATAAAAAAAAAAA
AAAAAAAAAAAAAAAAAA
back to top