DN135226

Overview
NameDN135226
Unique NameDN135226
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length664
Libraries
Library NameType
Mature Juice Sac from Navel Orange in Vulnus5 vectorcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionwca08b10 Mature Juice Sac from Navel Orange in Vulnus5 vector Citrus sinensis cDNA clone wca08b10 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DN135226 ID=DN135226|Name=DN135226|organism=Citrus sinensis|type=EST|length=664bp
GGCCGGGGCCTGGTTTTCATTGGTATTCGCCTTGAACAGCAATTTGGGTT
CGTGCGGATTGGAGTTATTTACCTGTTATCTGGATTTGGTGGGAGTGTTC
TTTCCTGCCTATTTATTCGAAACAGCATCTCTGTTGGTGCCTCCGGTGCA
CTTTTTGGGCTTCTGGGAGCAATGCTTTCAAAACTACTTACTAACTGGAG
TCTTTATACCAACAAGGCTGCAGCCTTGATTACTCTTTTGGTCATCATTG
CAATTAATCTCGCTATAGGAATTCTGCCGCATGTTGATAATTTCGCTCAC
ATTGGTGGATTTCTCACTGGGTTCTTCCTTGGTTTTGTCTTGTTGCCCCG
TCCTCGGTACGGATGGCTTGATGGCAGGAACCTTCCTGGAAGTGCCGCCA
TAAAATCCAAGTATAAGACACATCAATACGTGTTATGGCTGGTCTCTCTG
GCTCTACTAATTGCAGGATTAACAGTTGCACTGGTGATGCTCTTCCGGGG
AGAGAATGGTAATGATCGTTGCANNTGGTGTCACTACATGAGCTGCGTTC
CCACCTCCAGTTGGAATTGCGAAGGAAATGTGTAAATTGCAATTGCTAGC
TCTACGTTCACATGTAAATGCATGCATNGNTATAGCTTAAAAGCTGGATT
TCTTCATGCTTGAT
back to top