DN135220

Overview
NameDN135220
Unique NameDN135220
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length609
Libraries
Library NameType
Mature Juice Sac from Navel Orange in Vulnus5 vectorcdna_library
Alignments
Feature NameTypeLocationAnalysis
DN135220_ssr58 microsatellite DN135220_ssr58:58..67.
DN135220_ssr308 microsatellite DN135220_ssr308:308..321.
DN135220_ssr522 microsatellite DN135220_ssr522:522..551.
Csv1_Contig5703 contig Csv1_Contig5703:1..609. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionwca08a10 Mature Juice Sac from Navel Orange in Vulnus5 vector Citrus sinensis cDNA clone wca08a10 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DN135220 ID=DN135220|Name=DN135220|organism=Citrus sinensis|type=EST|length=609bp
CGGCCGGGGANNTCTGTTATTAATGAAATGAAAATATGAATATGAATTAA
TGAATTTTCTCTCTCTCTTTCTCTCGCTTCTCTCATGTCATATCAAATCA
TGCAAGTAGGCAGTGGCACCCTTAAAATCTAGTTAAGAAAATCACTTCTC
CCCACGACATATTTTGTATATAGGCGAAGCCAGTTCATTTCACTCTCACC
AAAACACCACAACTGCTCACTCTTCTCTTTCTCTTTCTCTGTCTCTGTCT
CCAATCACGCTCATACACGCATACACACAACAACCGCGATAGCAATAAGT
TTCGCTCCTCTCTCTCTCTCTATTCTATAATCCCTCTCCTCTATCTAGCT
ACTACTAGTAGTAATACTCCTTCAACGTTTTCTCCACCAGATCTCTCGGA
GTGACTCAGCAAAGATGCGTGCTTTTTAAGCCTTAACACTCGCCATTTGA
TTTCTTTCTCTGGGTCTTTCCATTTTTACCCAAATACACCATCTTTATTT
TAACATTGCCCTCTTCTTTATTTATTATTATTATTATTATTATTATTATT
ATTTTTGGTTTGATTTGTGTGCTTGTGAAATTGGAAAAAAAAATATGGCT
AATGGGGTT
back to top