DN135216

Overview
NameDN135216
Unique NameDN135216
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length470
Libraries
Library NameType
Mature Juice Sac from Navel Orange in Vulnus5 vectorcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2573 contig Csv1_Contig2573:442..905. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionwca08a02 Mature Juice Sac from Navel Orange in Vulnus5 vector Citrus sinensis cDNA clone wca08a02 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DN135216 ID=DN135216|Name=DN135216|organism=Citrus sinensis|type=EST|length=470bp
CGGCCGGGGGCCATAACTTGCTTACTGAATCAATTCTTTGTTTTCACATA
TAGTTCTTGCTTCTTGTTTTTCTTCAGCAGTTAATATTAACACAGATGGG
GCAAATTAGCAGCTTTAAGTCAGTCATGATGGTGTTCGTTTTGGCAGCTT
TTGCAATGGCTGCTGCTTCAGCTCAAAGCACCGAGATGGCCCCGGCACCA
TCTCCTTCATTGGACACCGGAGCAGCCTCTTCTCTTCCGGTTTCCGGTGC
TGTTATTGCATCTTCGCTGTTTGTTTCTCTTCTCGCTCTCCTGAAGCACT
AAGTCGTTTGGTAATGGAAGAAAATCATAGTTATTACTAAAATATTATTT
TCGAGGATGATTGGAGATTAATGTATTGAATTATTCATTTGTTCGTTTCA
TATTTCATACTATTAATGACATAATAATACTTATTCTTTCGCAAAAAAAA
AAAAAAAAAAAAAAAAAAAA
back to top