DN135043

Overview
NameDN135043
Unique NameDN135043
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length290
Libraries
Library NameType
Mature Juice Sac from Navel Orange in pTriplEx2 vectorcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2573 contig Csv1_Contig2573:443..732. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionwca05d03 Mature Juice Sac from Navel Orange in pTriplEx2 vector Citrus sinensis cDNA clone wca05d03 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DN135043 ID=DN135043|Name=DN135043|organism=Citrus sinensis|type=EST|length=290bp
GGGGATTGCCAATAACNNGATTACTGAATCAATTCTTTGATTTCACATAT
AGTTCTTGCTTCTTGTTTTTCTTCAGCAATTAATATTAACACAGATGGGG
CAAATTAGCAGCTTAAAGTCAGTCGTGATGGTGTTCGTTTTGGCAGCTTT
TGCAATGGCTGCTGCTTCAGCTCAAAGCACCGAGATGGCCCCCGCACCAT
TTCCTTCATTGGACACCGGAGCAGCCTCTTCTCTGCCGGTTTCCGGTGCT
GTTATTGCATCTTCGCTGTTTGTTTCTCTTCTCGCTCTCC
back to top