DN135038

Overview
NameDN135038
Unique NameDN135038
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length122
Libraries
Library NameType
Mature Juice Sac from Navel Orange in pTriplEx2 vectorcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2614 contig Csv1_Contig2614:121..242. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionwca05c08 Mature Juice Sac from Navel Orange in pTriplEx2 vector Citrus sinensis cDNA clone wca05c08 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DN135038 ID=DN135038|Name=DN135038|organism=Citrus sinensis|type=EST|length=122bp
GGGATCACAGCAANNNNAAGCAAGTTTCGTACAATAAAGAGCCCTCTATT
TCCAGTTTTAAGTTCTAAGTTCTAAGCTCAATCAACATGTCGGACACCTG
CGGCAACTTCGACTGCGCTGAC
back to top