DN135036

Overview
NameDN135036
Unique NameDN135036
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length618
Libraries
Library NameType
Mature Juice Sac from Navel Orange in pTriplEx2 vectorcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig5687 contig Csv1_Contig5687:1..614. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionwca05c06 Mature Juice Sac from Navel Orange in pTriplEx2 vector Citrus sinensis cDNA clone wca05c06 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DN135036 ID=DN135036|Name=DN135036|organism=Citrus sinensis|type=EST|length=618bp
GGGGGTCTTAAATACTCACAATTCCCACATACAGACACAGGAAAAAGANN
NNNNNTCACCTTCCTTCGGTTACGCTCTCAAAAACCCCGAGAAAAAAAGG
CTTCAATAATGGCATTCTCAAAGGCTTCAATGGCTACGCTGATGATGGCC
GTTGTCCTGGCCGCCTTGGTTCTCGCAGGGTCGGCTCAAGATCTCTCTCC
CGCTCCAGCTCCCGCTTCCGGAGCCGGCTCGATCTCGCCTTCCTTAGCCG
CCGCTGGTGTCGCTCTCCTTTCCGCTCTGGTGTTCGGCTCAGTTCTCAGG
GTTTAAGAGGCCGGTTCTCTATCTGATTACGTGTCACTGGCTTATTGGGC
GTGTAGAGTGGTTTCTTCATATTTTTTTTTCTTTTTTTGCGTTGTTTAGA
CGTTATGTGGGCTTAGTAGCGGCGGATCCACTGGGTTTTTAGTCTTTTAG
GGAGTGAGTCTTATTACATATAAATTTTATAATGAGAGAGAGTTATCAGT
TATGCTTTGTAGCTCACGGAGATGTGATGATATGATTTGATTTATGTTTG
TTATTTTGGAAACTTATGATTATTATCAGTATATATTAAGCTATTCCTTT
TGTTGTTAAAANNNAAAA
back to top