DN135035

Overview
NameDN135035
Unique NameDN135035
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length225
Libraries
Library NameType
Mature Juice Sac from Navel Orange in pTriplEx2 vectorcdna_library
Alignments
Feature NameTypeLocationAnalysis
DN135035_ssr105 microsatellite DN135035_ssr105:105..124.
Properties
Property NameValue
Genbank descriptionwca05c05 Mature Juice Sac from Navel Orange in pTriplEx2 vector Citrus sinensis cDNA clone wca05c05 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DN135035 ID=DN135035|Name=DN135035|organism=Citrus sinensis|type=EST|length=225bp
GGGGGAGTGGAGATGNNNNNACTTCTGCTTTCTATCGTCTTCGTTTTCAA
AGTCAAAACAAGAGCAAACCAAATCAAACCGGAGCATCATATTTAAATTG
AAATTATATATATATATATATATAAAACTCATACGCCAACTTTCTTGTAT
TTGTTGCCCCATCTCACTCCCACAACTCTTTCTTTGATTTTCCCACAAAA
AAAAAAAAAAAAAAAAAAAAAAAAA
back to top