DN135034

Overview
NameDN135034
Unique NameDN135034
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length634
Libraries
Library NameType
Mature Juice Sac from Navel Orange in pTriplEx2 vectorcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
DN135034_ssr334 microsatellite DN135034_ssr334:334..345. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig5686 contig Csv1_Contig5686:1..637. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionwca05c04 Mature Juice Sac from Navel Orange in pTriplEx2 vector Citrus sinensis cDNA clone wca05c04 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DN135034 ID=DN135034|Name=DN135034|organism=Citrus sinensis|type=EST|length=634bp
GGGGGCGACAATTCANNNCTTCGACTTCCATCGAATTGACGAAAGCAATA
AACCTAATCGCCGATTGAGTTATAATAATCATAGTAAAATTAATGATTTT
TCAATTAATTGATATCAATCGATAGATAAATAAAGAAATAAAAAAATTTG
GGGATCGGTGGGCTAGCTGCATGAAAAAGAAGAAAGGGGAACTGGAGGGG
AAGATCAGAGAGCTTGAAAAATAACAGAAGCAGACGGAAGCTAAAACATG
TCTGCAATTCTGTGCGGAAAGAGATCTTTCTTTGAGGATAATTTAGCTGC
CACGTCACCTCCCGTTTCCAAGAGAATCCGTTGTTCTTCTTCTTCTCCGG
TCCGGTTCTCTCCTCCCCGCTCCAGTCGCTCGCATCTCCTCGACCAGCTC
GCCGCTATCTTCCCTGACATGGACAACCAGATTCTTGACAGAGCGCTTGA
GGAATGTGGAGATGATTTGGATTCGGCTATCAGGAGTTTAAATGAACTTC
GTTTGGGATCTGCTGATAACAATTTAGGCTCTGTTGCCGGCAAATCTGAT
TTAGCCGCTGATGCCAATGCTCAAGGTGTTGCGACAACCAATGGAGAGGT
TCCATCTCCTGACGATCCATCAGCTTCAAAAGTC
back to top