DN135030

Overview
NameDN135030
Unique NameDN135030
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length102
Libraries
Library NameType
Mature Juice Sac from Navel Orange in pTriplEx2 vectorcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig13002 contig Csv1_Contig13002:33..134. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionwca05b08 Mature Juice Sac from Navel Orange in pTriplEx2 vector Citrus sinensis cDNA clone wca05b08 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DN135030 ID=DN135030|Name=DN135030|organism=Citrus sinensis|type=EST|length=102bp
TTTTTTTTTTTTTTTTTCCAAAACTTTCAGGAAAAAGAGATACAGAGAGG
CAATAAAAAAGTTCTCTCTGATCCTTCTTTCCTGGAATTGGATACTTATT
TT
back to top