DN135028

Overview
NameDN135028
Unique NameDN135028
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length375
Libraries
Library NameType
Mature Juice Sac from Navel Orange in pTriplEx2 vectorcdna_library
Alignments
Feature NameTypeLocationAnalysis
DN135028_ssr64 microsatellite DN135028_ssr64:64..75.
DN135028_ssr40 microsatellite DN135028_ssr40:40..59.
Csv1_Contig5685 contig Csv1_Contig5685:1..375. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionwca05b06 Mature Juice Sac from Navel Orange in pTriplEx2 vector Citrus sinensis cDNA clone wca05b06 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DN135028 ID=DN135028|Name=DN135028|organism=Citrus sinensis|type=EST|length=375bp
GGGGATTGCNNNATNNNAATAACAAAAACAAAGTAAATTAAAGAAAAGAA
AAGAAAAGAAAAAAAAGAAAGAAAGAAGAAAAATTGCTGTGGTAGTTGAT
AGTACAAATGTATTTATTCTTTATCTAGCTGGGAAAGGCTGGTATCTGAT
GAAACCAAACCAATTAGCAAAATTAAAGGTACCCAACTCAGATCAAGTCA
ATTTAATCTCTCCTTTTAGGAGTGTTCTATACTAAATCTTAAACCTAGCT
ATCAAAGCAACCTGATCCCAGCTTCTTGCCCTAAACAACAAGATCTGCAG
AAACAAAATCTACTAATTTATAATTTACTTTTTAGCCTAAAGAAACGCAA
AAAAAAAAAAAAAAAAAAAAAAAAA
back to top