DN135027

Overview
NameDN135027
Unique NameDN135027
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length207
Libraries
Library NameType
Mature Juice Sac from Navel Orange in pTriplEx2 vectorcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2077 contig Csv1_Contig2077:1..202. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionwca05b05 Mature Juice Sac from Navel Orange in pTriplEx2 vector Citrus sinensis cDNA clone wca05b05 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DN135027 ID=DN135027|Name=DN135027|organism=Citrus sinensis|type=EST|length=207bp
CGGGCCGGGGGAACCAACAAAAGACGAACGNNNNCNNNNTTGGCAGTAGC
AAACATCAACAACAGCTAATACTCGCAAAAGAATGGATTTCAGAATCATG
GGTTTGGACTCATCGCCACTCTTTTCAACTCTGCAGCACATGATGGAGAT
GGGGGCGGACGACTCCGCTGACAACAAGTCATCCAACGCGCCGACGCGCA
CGTACGT
back to top