DN135024

Overview
NameDN135024
Unique NameDN135024
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length192
Libraries
Library NameType
Mature Juice Sac from Navel Orange in pTriplEx2 vectorcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Properties
Property NameValue
Genbank descriptionwca05a07 Mature Juice Sac from Navel Orange in pTriplEx2 vector Citrus sinensis cDNA clone wca05a07 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DN135024 ID=DN135024|Name=DN135024|organism=Citrus sinensis|type=EST|length=192bp
GGGGGGTGCGACCATACCATCACTAATGCACCGGATCCCATCAGAACTCC
GCAGTTAAGCGTGCTTGGGCGAGAGCAGTACTAAGATGGGTGACCTCTTG
GGAAGTCCTCGTGTTGCACCCCTCTTTTAAAAAGGAAAAAAAAAAAAAAA
AAAAAAAAAAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
back to top