DN135023

Overview
NameDN135023
Unique NameDN135023
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length574
Libraries
Library NameType
Mature Juice Sac from Navel Orange in pTriplEx2 vectorcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig5684 contig Csv1_Contig5684:1..574. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionwca05a03 Mature Juice Sac from Navel Orange in pTriplEx2 vector Citrus sinensis cDNA clone wca05a03 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DN135023 ID=DN135023|Name=DN135023|organism=Citrus sinensis|type=EST|length=574bp
GGGGGACCACTCCAATCTAAAAATTTTGAGCCGCCACGAGGCGGAGCTCA
GACGTATTCACACGTTACCAAATATTTTTCCTTTCCATGGACTCTGAGTC
TTTTATCTAGTTGAAACACAAAATGTCAAAATCTTGCAAGGGCCTTGCTA
TGGAACTGGTGAAGTGTCTTAGCGAATCTGACTGTGTTAAGGTGGAGAAA
AGATCTTTTAGGGAATGTGCTGGAGAGAAGAGCCCATGTATACCAAGTGA
ATGTGTGGGACTAAGGGAAACTTATTTCAATTGCAAGAGAGGCCAGGTTG
ACATGAGAGCTAGGATACGTGGAAACAAGGGTTACTAAAAGCAACTGCAG
GATCAAGCTGTTGGCATCAACATTATACTCTCAGACAATTGATGCTCCAA
TAATAATCGAAAGGGGATTACAAAGGAAAAAGTATTCAGGCTTAAGAGAC
TTGAAGGAATATTTTGATATGTGAGCTTCTGGTTGCAGTTTTCTTAGGCT
TTGTGTACAAACAAAAATTGGATTGGATAAAAAATGACATTTTAAGTCAT
TTGAGATTTTTTTCCTCCATTTGG
back to top