EY659340

Overview
NameEY659340
Unique NameEY659340
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length337
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig12838 contig Csv1_Contig12838:18..354. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionCS00-C1-101-002-B01-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY659340 ID=EY659340|Name=EY659340|organism=Citrus sinensis|type=EST|length=337bp
CCACGCGTCCGCCCCCGAAACTCTCCTCTCCTTCTTTCTCTCTCTTTCTC
TCCCTCTCTGAGACAAAAGCACAAACGCTTTCTCCGCACTCGACTAAAAT
AGAGAATATGGCAATTTCAGCCTCAGCAGCAGCCACCGTAGCTTCCACTT
CTCCAAAACTCACGCACCCTTACGCCTCCGCCTCTCCTTCAAACTCTTTA
CTCTCCACCACTGCTCTGCGTACTAAATTAACCCCATCCAATCTCTCCTC
CTCCTTTCTCCCCCCATTCGCCACCACCACCGCTGTTACTGTCACAACAA
CTCGCCGCCGCTCCCTCATCGTACGCGCCGCTCGTGG
back to top