EY659221

Overview
NameEY659221
Unique NameEY659221
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length657
Properties
Property NameValue
Genbank descriptionCS00-C1-101-004-G03-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY659221 ID=EY659221|Name=EY659221|organism=Citrus sinensis|type=EST|length=657bp
CGGNATTCCAAAGCCGACCCACGCGTCCGTTTTGCTTAATGGCAGTGGCT
TTTGTAAAAAGAAATCTTGTGGAAACCAAAGGAAAATCACTCCAAGAAAT
TGAGATAGCTCTTCTTCCGCAGGAATAATGGAAGTTATTTTCCTGTTTAA
AGAAACTTCAGTATAACAGATGTAAGCAAGTGTTGCTTATCTGATAAAAG
GTATTCGTGCGGCTGAAGCAAGATGAGATACCAGAATGTTAGAATTGTCG
ATTGGAAAACCCTTGCATATCTACAAATATGATCGGGTAAATGCTGCATA
TGAGTTCTAGTGGAGTGTGATCTAGCCTTTATTTCACTGGTCAAATTTCA
GCACGGGCAGGCCTGGCCTTTTTGAAGCTTTGATTTGTGATTACATATAG
TCTTAAATATGTACTGCCCTTAATATTCATAACTGGGGTAGGAAATGCAT
ATTGTTCCTATATGATGTTGAGTTGCTTGCTTAAAGATCTAGTGTTGGTC
TCAAATCACTTTTGGCTTATAATAGTTGACGGTGACCTGCGGTGGAGAAA
GCTGGCAACTCAAAATGCAATGCTTAAATAATCTGTTAATCACATAGGGG
AAATTTTGGATTAACCCTCATGATGGATTTGGTTTCAAAAAAATAAAAAA
AAAAAAA
back to top