EY659074

Overview
NameEY659074
Unique NameEY659074
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length444
Alignments
Feature NameTypeLocationAnalysis
EY659074_ssr190 microsatellite EY659074_ssr190:190..207.
Csv1_Contig7957 contig Csv1_Contig7957:27..479. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCS00-C1-101-001-B02-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY659074 ID=EY659074|Name=EY659074|organism=Citrus sinensis|type=EST|length=444bp
CCACGCGTCCGGGCGCATCTTCTAGTTATGCTAAGGCTTCAAGTTTAGGA
GCAAGACCATCTTCACTAATAAGTTCAATCACAGCAGGAGCGGGCTCGCT
TAATTGCAGGAAAGGCAAGCCTTGCTAGTGCCCCCAACCACCCCAATCTG
GGCCCAATAATAAATGGCTGAGGGAAGAATGAAAGGATAAATAATAATAA
TAATAATAAGTTTAATTGTAATTACAAGTGTAGGATTCGTATTCTTGTAA
GTTAATGTTGTTTTTTTTTTTTCCCTAACATGTAAGTGTATATAAGATTG
TGGAGCCTGTTTGTATAAAACCCACCATTATGTGATTCTGTAAAGAATTG
TGATGGGGGTTAAGAAAAACAAGAGCCGAAAGAAGTGTTTGATATACGTC
TATGTATTTTTATAAAAATAAATAATGTTCAATTAAAAAANAAA
back to top