DT214575

Overview
NameDT214575
Unique NameDT214575
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length799
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig7507 contig Csv1_Contig7507:344..1142. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS10_5E04_b2 Madame Vinous Sweet Orange Multiple Pathogen-Infected cDNA Library UCRCS10-2 Citrus sinensis cDNA clone UCRCS10-5E04-I7-6.d-polyt, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DT214575 ID=DT214575|Name=DT214575|organism=Citrus sinensis|type=EST|length=799bp
AGGAGAGTCGTTGAATTGCCCATAAGTTGATTCACAGGTGTCAAGCCATT
ATCACTTACAAGGGGCAAAACTGATGGCAATCAAGCTATGATTTCCCTAA
CCAACCAATCCAAAATGGGTAAGGCGAAGTACAATACCAAGCAAGATGGG
ATAGCAAACACAATGGTAATGAGAATGTAAAGGGCCAAGATGGCTGCACT
GGCAGGTATTGCATACAAGATGATCAAAATAAGTACGATAATCAACGGGA
ACTTGGCTGTCAGCTGCGCAAAGAAAACCAAGGATTTACGAAGAGATAAT
TGTAGTCTTTCAGCATTAAGGTGGCTAGTAAGAAATCGGCCTTCATCACG
ACGGATTTCAGACTGCCTTGAGACATGACTACAAGTGGCTCGCCCGTTAT
GTGCGTGGCTAACTTGATTTCTAACAGCAGAGTTTCTATTCAAAGAACTG
GCCGGTTGGTGATCCCCTCGGAAATGAGGGTTTGATTTGGACCTATCACC
ATTCATGCTTTCAACCATCCAAAGGAGGTAGTAGTTCTTTTGAGGAAACC
TGAGATTCCCCTTGCAGATCAGCCTCAACGACACCATATTACACCAGGGG
CAAGTTATAAAGAACGGAAGCTGGAATGGTAATGTGGGCAATCTAATAAC
AGCACGTTGTAGCCCTAGGACACAATTCTTGCAAAGTGTGTGGCCACACC
ATAGAACATAGGGCAGGTTCTCAACAACATTGAAGGATTCCCAGCATATC
GGGCACTCCAAACCTTCTTCTCTGCTGTTGTTTAAAGAAGCATCATCGT
back to top