DT214572

Overview
NameDT214572
Unique NameDT214572
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length129
Properties
Property NameValue
Genbank descriptionUCRCS10_3E02_b2 Madame Vinous Sweet Orange Multiple Pathogen-Infected cDNA Library UCRCS10-2 Citrus sinensis cDNA clone UCRCS10-3E02-J3-5.d-polyt, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DT214572 ID=DT214572|Name=DT214572|organism=Citrus sinensis|type=EST|length=129bp
TTAAATGAGTAATGGTAGAATATTTGATTTTGTTTTAAATTTTATTTTGA
ATGACTTAACATGTAATTTGTTTGTCATCCATTAAGTTGTTAACCAACTA
AATTAATTGTCTTAAAAAAAAAAAAAAAA
back to top