DT214567

Overview
NameDT214567
Unique NameDT214567
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length667
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig6415 contig Csv1_Contig6415:20..686. BLAST: Citrus Unigene V1 Contigs to Trembl
Properties
Property NameValue
Genbank descriptionUCRCS10_22H01_b2 Madame Vinous Sweet Orange Multiple Pathogen-Infected cDNA Library UCRCS10-2 Citrus sinensis cDNA clone UCRCS10-22H01-O2-5.d-polyt, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DT214567 ID=DT214567|Name=DT214567|organism=Citrus sinensis|type=EST|length=667bp
CTACTTTGATATAATTAAAACATACAATGAAAAAAATAAAAAAGGAAAAC
CGTCTCTTGATAACTTGAAAATCATGATGTACAAGATCTTACAAAATCGT
ACATCATTTTCAAACCAAAGACTGATACAATGACCCCACAAATTTCTGCG
ATGGATCCTAGTCCATAATGCTAATTTTATCGACTAGAAAAAGCAACTGA
AGTACAAGAGTAGCAAATATTCTCATTTGACTCGGAATGAAACATTACAG
TTAACTTCTGCACACTTAACTACATTTTATTTCCAAATTTCTTCCTGGAT
TTTACAACAATCTGCTGGAAAAGGAGTAACTTTAAAAGTCGCGCTCTCGC
TTGCAAGAACTAAGGCTTCTGTGCAATGTTCATAGACAAGAGAGAGTGGC
ATTATCATTATCACTGTAGTTTCACTATCCACAGACTAGTACCCCACAAA
ATCCTCATGCTGATACCAGCTGCAAACTCTTGTAAATAACTAGGACATAA
AGCCAAAACTTCTCATTCAATTTGCAGGCTCTCTTTTGAAGGAACCAACA
GGAACCACACCAGCGGAATCATGATTTGTGCCACTCAGAACATCCATACC
CTGATTATTTGAAGCTTGCCCCCGATTGGGCCTCGCATTGAGATCAATTA
ATTTATTGTCCACCTTT
back to top