DT214560

Overview
NameDT214560
Unique NameDT214560
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length892
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig9497 contig Csv1_Contig9497:708..1599. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS10_19D02_b2 Madame Vinous Sweet Orange Multiple Pathogen-Infected cDNA Library UCRCS10-2 Citrus sinensis cDNA clone UCRCS10-19D02-H3-5.d-polyt, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DT214560 ID=DT214560|Name=DT214560|organism=Citrus sinensis|type=EST|length=892bp
TATCTACTAGACTTTCAAGTGATGATCTCCTAAAGAATTAACTGATAGTC
TAATCCATTAAAGAACGCATCAAACATTTACACGTGGAAGTCAATCATGC
CACATTTGTACCATTTCGTGGACATATATACACGCCGACAATTTCTCAGG
GTTTCCTGGTTTACAATTTAGAACAGAAGGAATAAAACATCTAGTATAAC
AATCTTCTATGTGATCCACAGATATCTTACAATATCTCAACACAGATATC
TTACAATATCCCAACGCAAATTTGCGAGCTGTCATAATAGATCTTCCTTG
TATGACAAAGTTTCTGCAATGCATTATTGAAGATGAATTATGGTTTCAGA
AAATGTTGCAGAATCTTCCACATGTCCACTTGAATCATGGATCACTTTAC
TACCAATATGAAGTCAGACCAATCGCCCTGAGAAGGTTGTTCGATAGACG
GATGAAATTGATGGCTATGTGCAAAAAACAAGACTCCTCCAGAGTTTTGC
TCTATTGTTGATTTGACAAAGGTTCTCTAACAGTTGTCTTCATGTGCCTA
CCTAGAAGATCAGCAATGGCTTGTATTAATGACTTTGGGTCAAATATTAT
ACCCACTTTTGGATCACATATGGAATGAACAGTGATCACATCAAAAATTC
CTTGGGAAGCCAAACATTGAATGTCTAAGGGAATTTCACCATCTTCAGGC
ACCAAAATTGTGTTGATATACTGACTTGGAGAGTTCTTAAGAGACTTTTG
AGGATCTCCATATGCTCGATTTAGAGCATCAGTAATGGCAGTCACAAAGC
AAGAAGCTGAGAAGCCACTGGTTTCTCGATCTTCTAAACCATTCAACAGA
AGTACCTTTGGACAAGACCTTGAAGATATTATCTCCCCAATG
back to top