DT214559

Overview
NameDT214559
Unique NameDT214559
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length655
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionUCRCS10_15F09_b2 Madame Vinous Sweet Orange Multiple Pathogen-Infected cDNA Library UCRCS10-2 Citrus sinensis cDNA clone UCRCS10-15F09-L17-6.d-polyt, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DT214559 ID=DT214559|Name=DT214559|organism=Citrus sinensis|type=EST|length=655bp
TTGGGGAAAATAATTAAAAAAATCTCTGTACAAAAAAGAGCGTCGTACCA
CCCTTTTAGCGTGCACAACTTTGTAAATCTCATACGTGGGCCACACTAAA
ATACAGAAATGCACTTAGCGATGTTTACTCCTTTTTCCTTCTCTTTTCTT
CTTCTTATGTTTACCCTTCTGCCCACGGCTAATTTTTCCACCTTCTATCT
TTGTCTTTCTAACAATACTTTCAGGATGAGAAGAAGCATCCTTTCCTCTC
TCCTTTTCACGCTCAACCTTTGGATCTACAACACTACTGCCCTGACCTTT
CTTCAGCTTCCTTCTTTCAGCTTTTGAAATATAAGGTTTATCTCTGACTG
TAGCAGTCCTCTCGACATGCTTATCTTCCTCTGACAAATCAAACTGAGTC
GTTTCAATCCCATGTTTTGTACTGGATATAGAAGCAAATCCAAGCCCAAG
AAACCTAGCGATGAGATCTTCAAGTTGAGGGGTGACCGGAGCAGCAACAT
TTCTCGCAATATCAAATATCTTACAATCAATACCATCTGAGATAGTTTTG
TCTTCAGCAGGAAATTCAAGACAATCAACATTACTAGTATTTGTTTGACT
CGGGGCAGGATGAAAAGAATTAGGTACACATAGAGCTTTCTGCTACAGGT
TTTTC
back to top