DT214558

Overview
NameDT214558
Unique NameDT214558
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length861
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Properties
Property NameValue
Genbank descriptionUCRCS10_15C09_b2 Madame Vinous Sweet Orange Multiple Pathogen-Infected cDNA Library UCRCS10-2 Citrus sinensis cDNA clone UCRCS10-15C09-F17-6.d-polyt, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DT214558 ID=DT214558|Name=DT214558|organism=Citrus sinensis|type=EST|length=861bp
ATAATTATACAGTGTATACAGACAAAACAAAGAAGAAAATAATAGATTAT
TCTACCTTTCTCAGTCATCAACCAAATGTTACATCCATTTTCATCATTCT
GTGCTTGCACTTAGCTCATCACCGAATTCTCCAGCCACAAACCTGGTCTT
CTTATTCTTCCAAGATTTCTTTGCCCTTATCAGTTATCTTGTATGAGCTT
GATTCAGTTTCAAGTTCTTGTCCGGTGGTAGTTTCATCAGAAGAAGTAGA
CATTGTCGAAACCCCATCAATTTTCTTACATATAACAAGACACTCCATGT
AAGCATCCCCATAGTAGCACCATGGCTCACCGCGAACTGTTAGTCTCCTG
GCTGTTCGATACCTGGGATGAAATGAAAGCAATGCCCAATTGTATACTGT
CCCGACTAGAAGTTCCCCCTTTCTCCAATTTCCTAGTATCTTGCCTACAC
CTGAATGTATTGTAACATTATACAGCTTTGTCCAAGACTCAATTGAACCA
TACTCATTCATCAACCAAATGCTACAACTAAGAAAAGCCTCATCTCTAGC
ATGTGAATGATAATGCAGCAAAGCAAGCGATTGTTTGATTACCGCAACAG
AGATCTTTTGCACTTCCCTTTCTCCGAATTTAACTGTATCGCTCATCACA
CCGTTTGGCAAATTAAATTCCTTAAATACCTCACCATACATATCAAACAC
GGCCACAACCAATTGAGAAACTGATCTCTCATCACTCCCTTCATAATATC
CAATCCAATGCACAGCTCCATTTACAGAGGCATGCACTGAATTTCTTTTA
ATCAAAAAAGGCGGTGCAGCCTCAGTGATGTTCTCCCACTCTCCTGTACT
TAGAGTTAAAA
back to top