DT214555

Overview
NameDT214555
Unique NameDT214555
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length668
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig4339 contig Csv1_Contig4339:14..680. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS10_13E05_b2 Madame Vinous Sweet Orange Multiple Pathogen-Infected cDNA Library UCRCS10-2 Citrus sinensis cDNA clone UCRCS10-13E05-I9-6.d-polyt, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DT214555 ID=DT214555|Name=DT214555|organism=Citrus sinensis|type=EST|length=668bp
CCCCCCCCCGCACACCATTGCTCTTTTGTTTATTAACTTCATAATACAAC
AAAGCAAGATTTGAGAATTTACAGAAGAACCCTTAAGGGAGACACACCAT
CCAGTTTTACAACGAAGTTACAAAAAGCCCCTGATCTACTAAAAAGGAGC
TTTTCAAGAGGTCAGATACCGATTTATATATAACACATTTTTGTTGCTTG
TTAACAGGTTTTAATATCAAGAATTATTAATTTGGCAGAGTGAATTGAGC
TATTTGCTTGGTGCAGAATCACCGGTTTTGAATTCTCGTTCGAGCTCATC
AAACTCCCAGTCGCCAATTTCCTCAGCTGAGTAGTCTTGGCCAACTTTTC
CAAACTCAGACTCCAACTTTGCCAACTCTGCTTCAGGGTCGAGTGCCTGC
TCTCCTTTGTGAACAGGTTTCTCACGATGCTCGCTTATATCAGGTTTTTG
AGTCGTACCTTCTCTGTGTAGGAGGAGGACTGGAAGGACTTTTGGGTGAC
ATCTCACTGGATGAAGTGCCAGTCTTTGGGCTAGGATTCTCCAATTCTAA
ATTTGGCCTCTCAATAGATTCAAATTCCAGTCTTAACTTTTCAATATCAT
CAAATAGCTCTTTAACCCTTGGATCATCTTTCCTGGAATTTGCTCCACGT
TGAGCATAAAATTGCTCT
back to top