DT214552

Overview
NameDT214552
Unique NameDT214552
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length257
Properties
Property NameValue
Genbank descriptionUCRCS10_11B12_b2 Madame Vinous Sweet Orange Multiple Pathogen-Infected cDNA Library UCRCS10-2 Citrus sinensis cDNA clone UCRCS10-11B12-D23-6.d-polyt, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DT214552 ID=DT214552|Name=DT214552|organism=Citrus sinensis|type=EST|length=257bp
TTCGACCCAACTCTTTACAATCCACCATGCCCCTTTAGGGAAAACCACAA
AATTCCACCAACAACATCTTGCCCTTTGAATTTTCTGAGAATTCAAAAAA
CATAATAATAGAGGCACACTAGTTGTTGGCATCATTCCAACACATTTATT
TACTCAGGCTAAATTTATGGCTTCAGCAAATCCTATCTCGAGAGAGCTTG
AGATGAGCCTCAGCATAATCAGCGAAGAAAGCGTCCTCATCCGCAGCATA
TTTCTCA
back to top