DT214551

Overview
NameDT214551
Unique NameDT214551
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length130
Properties
Property NameValue
Genbank descriptionUCRCS10_10F01_b2 Madame Vinous Sweet Orange Multiple Pathogen-Infected cDNA Library UCRCS10-2 Citrus sinensis cDNA clone UCRCS10-10F01-K2-6.d-polyt, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DT214551 ID=DT214551|Name=DT214551|organism=Citrus sinensis|type=EST|length=130bp
TGGTGATTCATGGAGCTGCTGCATATTCGTGATTTGTGAGAGGATGTTTA
CTTTAGAGATTTCATCAGTTGGGAATGTTACAGCTCTTGTGTAGCATTTT
GACTTTACCGAAATAAAAAAAAAAAAAAAA
back to top