DT214523

Overview
NameDT214523
Unique NameDT214523
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length731
Libraries
Library NameType
Parent Washington Navel Orange Callus cDNA Library UCRCS08-4cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig6526 contig Csv1_Contig6526:1..731. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS08_54C03_b2 Parent Washington Navel Orange Callus cDNA Library UCRCS08-4 Citrus sinensis cDNA clone UCRCS08-54C03-E6-1-4.d-polyt, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DT214523 ID=DT214523|Name=DT214523|organism=Citrus sinensis|type=EST|length=731bp
ACCAATACAGTTCCATTAACTAGCCTCAGCTCAGTAGCTGGATACTTATA
TCCAAGTAAATAAAATAAACATCTAGTTACACATATGATCTCCATAAAAT
TTTCGAGTCTCCATCCTCACAAGTCGTATCTCACATTCCACCGACCATTC
GCGTCAGCATTGACTGTCCAATTATTTTCTCTAATCTGCATATAGGGAGC
CTTGTCAACAACTTCATAACCAAGTTTGAATCGAACATCTTGATCTTTCT
GAAAATTGAATATGCTCCAAGAAAATTCAGCAGCTCCTCTAGACTTTCTC
TGTCAAGGTGGTATATGTGATAGCAGAAGGACACAAAGACCACATGTTAG
GATGCTGAGTTGCATTCTTTAGTATCTCTCTTATTGGAAACAAAAGATCA
AAATATAATTAAAGTGCAACTGAAAGCAAAAGCAAAACATATAATTAAAA
CAAAAAAAAGGGGGGCTAATGAAAATATTGTGAAGTTGTTAAACTTCATA
TACTGAGGACACCAAATAGGCAAATAGCATGAACATTGCTCTCTGTGAAC
CAATTACATCTGATATTGAATTATTCTAAGAACTCAGAGCATCCACCAAC
CTGTTTAAATTCCTTGTCAACTTCACATCTTCCCTTGATATTAAAGCTTA
ACAAAACCAGTACTTGTCACAGGAAAAACTTTCTTTTCCGCGAACGGTAT
ACCTTAGCTTCTCATGTTTATCATACTGTAC
back to top