DT214521

Overview
NameDT214521
Unique NameDT214521
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length373
Libraries
Library NameType
Parent Washington Navel Orange Callus cDNA Library UCRCS08-4cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Properties
Property NameValue
Genbank descriptionUCRCS08_51F05_b2 Parent Washington Navel Orange Callus cDNA Library UCRCS08-4 Citrus sinensis cDNA clone UCRCS08-51F05-L9-1-4.d-polyt, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DT214521 ID=DT214521|Name=DT214521|organism=Citrus sinensis|type=EST|length=373bp
ATATGTTGAAACTTTCGTATTTACAAAAACTTGTACATGTCCCTTAGGGG
TTTGGCCATAGTCAGGACAAGAAGTAGAATACCCTTGCTTCGAAACTTCA
AAACCTAATCCCATGGAGGAAACAAGTTTCGAAAATTAAAAAACACAATC
ATTTGCAATTTCTAGCAAAATATTTTCACTGCTATTTATAGTTCATGCAT
CTTCATTAGTCTTAACAGGAGTCCAGCTCCTTCCTGATGTAGCTGCCTTC
TTGGTGTGAGAAATGTAGCCAATGACATAGCCCACAAAAGCCCCCAGCAC
CAAGATACTTGCTCCCTGGACAAACCATGAAAAAGTAGACTTGGTTAACT
CACCTCTAGGTCCAGAACCAGAC
back to top