DT214520

Overview
NameDT214520
Unique NameDT214520
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length513
Libraries
Library NameType
Parent Washington Navel Orange Callus cDNA Library UCRCS08-4cdna_library
Properties
Property NameValue
Genbank descriptionUCRCS08_49E03_b2 Parent Washington Navel Orange Callus cDNA Library UCRCS08-4 Citrus sinensis cDNA clone UCRCS08-49E03-I5-1-4.d-polyt, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DT214520 ID=DT214520|Name=DT214520|organism=Citrus sinensis|type=EST|length=513bp
AAAATTTGTACAGATGAACTAATTGTTTAGTTTCTACAGCATCCCTTTAG
GGCGGCTGAAAAAATTATCCCTACTCCAGCTACAATGCTCTTTTTGTATT
TCCCATAAATCAGGCTTTAGTAATTATTTTCTTGTCACTTTCTAATTTTC
TTTTCCGCAACATTTACATGGTCAGACCTATATTCCTTACAATACCTACA
AATGTACAGTTCATCATCCGCAATCCCACTTCGATTCTGCAGATGCAAAT
GATCCGAGTATCCAGACCATGGTTGCCTCTAATCCACATTTTCCTTTCTA
AATCATCCCTTGTGAAATGACACATTCCAAAACCCTGAGATCGGAGAAGG
AATTGGAGTTGCAATGGTCAAATGAATTGCTTATGCCACAGGCCATTGTC
GCACCTAAGAACCACACAACACACAGCCTTGTCATTCTGTGGATTGATTG
AGGTTCAACAAAAACTACCGGTGTGGCACATAATTCATGGAAATTCCAAG
CACCTCAAAAACT
back to top