DT214519

Overview
NameDT214519
Unique NameDT214519
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length525
Libraries
Library NameType
Parent Washington Navel Orange Callus cDNA Library UCRCS08-4cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig3192 contig Csv1_Contig3192:116..640. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS08_43A08_b2 Parent Washington Navel Orange Callus cDNA Library UCRCS08-4 Citrus sinensis cDNA clone UCRCS08-43A08-B15-1-5.d-polyt, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DT214519 ID=DT214519|Name=DT214519|organism=Citrus sinensis|type=EST|length=525bp
AAATCTTATGTGACAGAGGAGGTTTGGTAAAGTTCACTTCCTCCCACGGA
TCAGTACAAACACAACCTACATACAAAAGGGATGTGGCCAGATTGACACT
CTCTAATAACATTTGCACCATTTCCGACAAGACACAGAAGCATTTGGGAG
ACAAAGTCTCATTTGATCAACAGAATACAACTGAGCTTAATCCATTACAA
ACCATCTTAGCGATCTTCCCTTCTAACTGCATTTGGATCAGACATCATGT
CCATCATCATCTTCTCTGGTGAATCTTCCCAGCTAGCAAATTTTTTCAAG
TCAACCTTGCGTCTTTGCTCGGTGAAAAGTTCCTCTCTTTTCATGTATGA
CATCCCCCTTTGCTTCGCTGACCTCCCACCTATTCCCCAAACTTCAATTT
CTAAAATCAGAGATTCAACTGGGAGAAATCCCTGATGTGGAATAAGGGAG
CCGTGTTGGTAGGTTCTGCCAACTGCTTGATGACGAACAATAACTCTAGC
AAAATCTTCATCAATAAAGATCCTC
back to top