DT214515

Overview
NameDT214515
Unique NameDT214515
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length890
Libraries
Library NameType
Parent Washington Navel Orange Callus cDNA Library UCRCS08-4cdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig3568 contig Csv1_Contig3568:206..1096. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS08_36E03_b2 Parent Washington Navel Orange Callus cDNA Library UCRCS08-4 Citrus sinensis cDNA clone UCRCS08-36E03-J6-1-4.d-polyt, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DT214515 ID=DT214515|Name=DT214515|organism=Citrus sinensis|type=EST|length=890bp
TCTATTTCCGATTGTCACCTGAAATTTTCGATATAGATGTAAAAGGTACA
TAAGATGATGAAATCGACAATGAAGCCGACGATGATCATCAATGGTAAAA
CCGACGCTAACATAAGGTCTGATCTTATCATTACTTTTTTACTACTGTGA
TTGCTGAACCTCCGATCCCAGAGAATATTTACATCTTAGTCTACTCTTTA
CCAACTATATATATGTTGACATATCTATCTTTCGCCAGGCATATCAATCC
TACAAAACAGACCTAGACATCCTCAAAATTCTACCAGCCTAGTGGCATGT
TTTATTTTTCTCCTTCACCACTAGTTTTACTTAACAGGTGGTTAACGCTA
TCTTAAAACTTGCATGAAGTTCCCAACCTCTGCCTCTGCCCATGCCCAAT
AGTCGTGTGCCTTTGCTTGGCCAAGGCAGGGTGAAGAAGCTCCTTGAACT
TCTCAAGAAACAGCAACCATTCTTCTTCGTTCATATCAGTGAGCTTCACG
AAGCTTGTGGTTGTAGGTAACAGCTCTTCTGCACTTCTTCTGCTCTCAGA
TACTGACCCACCAGGCATTTGCCTTCTGGTTTTCCATTTTGGTTATCTTG
GCTTCTCTCATGGGAGTCCGTTCTGTTTAGAGACAGGGGCAGCTTATCTC
CATAAGACTCTAAACTCCCCTCAGCTTCATCCTCTTCAAAACTCTCCACT
TCAGATGGCAGGTGATGTCCATTCAAAATGTTAGAAGCATAACTAAATGA
CCCTTGATTCAAGAAATCTCCAGACATCTTTGATGCCCAGTCAAACTCTG
CATCATCACAATCGATATCAAACAGAATGTCATCCTCTCCACTCTCAGCG
TCAAAGCCTGCAATTTCCCTCTCTGCTATGATCCTCCTTG
back to top