DT214514

Overview
NameDT214514
Unique NameDT214514
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length372
Libraries
Library NameType
Parent Washington Navel Orange Callus cDNA Library UCRCS08-4cdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig10494 contig Csv1_Contig10494:1161..1529. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS08_33B10_b2 Parent Washington Navel Orange Callus cDNA Library UCRCS08-4 Citrus sinensis cDNA clone UCRCS08-33B10-C19-1-4.d-polyt, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DT214514 ID=DT214514|Name=DT214514|organism=Citrus sinensis|type=EST|length=372bp
TTACAAGTAATTGATGACTGAAAAAGAAACCCTTGAGGGTGTCCGTCTAC
TTCTAGTAATACATTAAAACTCTTTAAAGGGGGGGGAAAAAATCATTCAA
ACAAAGGGCAAACAGAGTGCAATCTCACAGTCCTTTCCCGTACAGGATGT
CTTTCCCTGGTTGCTTGCCTTTTCTTTGCAAGCAGTATATGTATTTCATC
AGTATTCATCTAGATAAGTATATAGCATGTCATCTTTCTTTGATTTGCGC
CTACTAAGTAATGCCTTAAGGAGCCGTTTACTTTTGCTGGGGTGTTGGTC
AAAGCCTTTACAGGTTTCCCTTTCAGCACGCATACGCATAGAATATGATT
TTCGAGGCTCCGAACGGTACCT
back to top