DT214513

Overview
NameDT214513
Unique NameDT214513
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length719
Libraries
Library NameType
Parent Washington Navel Orange Callus cDNA Library UCRCS08-4cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig4558 contig Csv1_Contig4558:210..928. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS08_32C06_b2 Parent Washington Navel Orange Callus cDNA Library UCRCS08-4 Citrus sinensis cDNA clone UCRCS08-32C06-F12-1-5.d-polyt, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DT214513 ID=DT214513|Name=DT214513|organism=Citrus sinensis|type=EST|length=719bp
GAAACAGATATCATCTCAAGCTCATAATAAAGAAAGAACAAATCAGATCT
TTAAGAAACAGGAAAATAACAAATAATCTCCTATTGTATAAAGCCTGAAT
TAAGTACACAACAATATCTTCAATGATGATGCTGTTAACTTTTCGTGCTC
TCAAAGAATCTTGAAAGCGGCACAGGACCAACAGCCTCCTCATCATCACT
GCCAGAGTGCTTGGTCCTTGACCTGTGCTTCTTTTCCTTCTTTGATTTCT
TGGACCTGGACTTTGATTTTCTTGATTCTCTCTCTTCCTCATCACTACTA
GAAGATTCTGATGATGAACTCGAGGAACTTGAGTCAGAAGATCTCCGCCT
TGAATGCTTTCTCTTTTTGCTGCTGCGTTTCTTTAAGTCTCTGTCCTTCC
TATCCTTTTTACGATCAGACTTACTACCAGAGTGATTCCTTCCTTGGGCC
AGCTTGCGTGCCCTTTCAGCATCTAATTGGGCTCTGTACTCCCGCATCAT
TCTATCAGTATCTTTTTCCAGTTCACCTTTTCTCAGTTCATCTTCCTTTT
GCTTCTTTTTAAACTCTTCCCAGGTAACCGTGTGAGATGTTTTAAGGCTG
GCCAAACGAGCAGCATGCCACTCTGGTGAATGAAAAGACCCATCCACCAT
GCCATCCTCGATCTCATCAGGGGCAGCCGAGGAAGAGCCGAGGCGAGCTC
TCTGCATGGCTTTGTACGC
back to top