DT214511

Overview
NameDT214511
Unique NameDT214511
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length105
Libraries
Library NameType
Parent Washington Navel Orange Callus cDNA Library UCRCS08-4cdna_library
Properties
Property NameValue
Genbank descriptionUCRCS08_27D10_b2 Parent Washington Navel Orange Callus cDNA Library UCRCS08-4 Citrus sinensis cDNA clone UCRCS08-27D10-H19-1-5.d-polyt, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DT214511 ID=DT214511|Name=DT214511|organism=Citrus sinensis|type=EST|length=105bp
TATTTTGTAAGCCATAATCATAGCCACAGGGTACATTTGCCAACGTTTAT
AGTTGCCCTAATGCTGCAATAACCATCATGACCTACCAAATTTATTCATA
CTCCT
back to top