DT214508

Overview
NameDT214508
Unique NameDT214508
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length627
Libraries
Library NameType
Parent Washington Navel Orange Callus cDNA Library UCRCS08-4cdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig4983 contig Csv1_Contig4983:44..670. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionUCRCS08_21C06_b2 Parent Washington Navel Orange Callus cDNA Library UCRCS08-4 Citrus sinensis cDNA clone UCRCS08-21C06-E11-1-5.d-polyt, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DT214508 ID=DT214508|Name=DT214508|organism=Citrus sinensis|type=EST|length=627bp
GTCTATAAAAAAAATCATGAACATACACAAAAACTTACAAAAATAACTTT
CTGCTTTCTTTCCAATCAATTTTACACAGCTCACATGACCCTCTACCCTA
TATGGTTTAAAATGCCACAAAATTGAAAGAATTAGTAGAAGGATTTTTAC
TCAGATTGCTAGTTAAGCAAGTTTATCACCCTCACTCAATTGGTAATGTA
GCTGGAACAGTTGTTTCCTGAGCAGGTAATGTTGCTGGAACATTTGTTTC
CTGAGCAGCTGATGTACCTGGAACATTTGTTTCCGGAGTGCCCGGATCCT
GCGGTTTTTCTTGAGGATCTGTTACCTGCGATGGTCCCTCGGAAGCTGCC
TCATCAGTAATAGATGCTGCCGGAGCTCTTTCTACTGAAGCAGAAGCAGC
CAGATCTGAATTACTTTCTGAGGATTGAATAGGGCCTTTATCACCTGAAG
TTGGTTCGCTACCCTCCCCTGGGGGTGGAGTACTTTCTTCTGTGGGTGTC
GTCGTAGGTGGTGCTTCTACAGCCAACTGTTCACTTGGTTGCTGCTGTGA
ACCTTCTATTGCCAGTGGTTTGCCTGGTTGCTGCTGTGAACCTTCTACTG
CCAGCGGTTTGCCTGGTTGCTGCTCCT
back to top