DT214503

Overview
NameDT214503
Unique NameDT214503
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length641
Libraries
Library NameType
Parent Washington Navel Orange Callus cDNA Library UCRCS08-4cdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig4302 contig Csv1_Contig4302:51..691. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionUCRCS08_12H04_b2 Parent Washington Navel Orange Callus cDNA Library UCRCS08-4 Citrus sinensis cDNA clone UCRCS08-12H04-P8-1-5.d-polyt, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DT214503 ID=DT214503|Name=DT214503|organism=Citrus sinensis|type=EST|length=641bp
TGCTACCAAGCCAAATTTCCAAAGTCCTCGAGATCCTCCAAAATGCACCC
ATAACAACCAAAAGTCCACAACACAACTTGCAATCAAACCCTGTAACAAG
AGAGTTCCATAAGTTCAGCAAACGACGGCCGCGTAAAAGAAGACAAAGAA
ATGGGCCCAACGGCACAACCAAAATGATTTCTACCTCGTTCATCCATAGT
AATCACACTTCAGGGCTCCTCTCCTGCACGAAAGCTTTGGACCAATTCCT
CAAACCTCAATATTTTCAATGACCGTGCATTCTATGACCGTGCATCATCA
GCATCCGAGTCGCTTCCTGAAGAAGAGCCTGAATCCGAATCTGCATAAAA
CATTAACACAACTAAGCATTTCTCCCACACTTTTCCCATCTGCACAACAC
TCAAAAACACTTCAAAGATCAGATTGTGAGGAGTGTTGTACCACTCGAAG
ACGATGAATCACTACTTGAGCTACTAGAGCTGCTAGAGCTACTACTAGCG
GCATTGTTATTATGAGCATTATCCTTCTCAATCTCCACCGGTGGGAAACT
GCTCATTGGTATCTCATCACCAATGTCCACATCTTCATCCCCAGCTTCCC
CCTTCTTCGCCTTCTTTGCATCTGTCGCCACTTCAATTTTC
back to top