CX293887

Overview
NameCX293887
Unique NameCX293887
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length450
Libraries
Library NameType
FlavRip1cdna_library
Properties
Property NameValue
Genbank descriptionC05002B05SK FlavRip1 Citrus clementina cDNA clone C05002B05, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX293887 ID=CX293887|Name=CX293887|organism=Citrus clementina|type=EST|length=450bp
GTTTTGGACAAAATCCGAACAGCGAAACGTCATTACAGTCGCAGAGCTTT
CATGGTTCAAATCAAGCGCCCCACATGAAAGCTGAGCTTTAATCACAATT
CTTTTGGGTCCATAAGGAATTAAAAAAGGCAGCTGTATATACAAGATATC
TAATTTGGACCAGCACAAGAACCACGGAACCAATTTATCTCTAGGTCTAA
TGAAGAGGGCATTTTTTATGTTTCATTTTTTGGTCATTTCTTTCAGCTTT
TAGTTTCTGCAATGACTTTGTATTCTAATTTTTTTCCCACTTTTTTTGTG
GAGTATTTTCTTACAAGTATCCACTGTCAAATCCTAGAAAAGAAATTCTG
TAACTTTCACTGCAAATTCTTATAGCTCCGCTTCTACTACTGAATGTAAG
ATATAATGCTAATTAGAAACAAAGCTTTCACTAAAAAAAAAAAAAAAAAA
back to top