CX293900

Overview
NameCX293900
Unique NameCX293900
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length366
Libraries
Library NameType
FlavRip1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig6420 contig Ccv1_Contig6420:586..951. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC05002C08SK FlavRip1 Citrus clementina cDNA clone C05002C08, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX293900 ID=CX293900|Name=CX293900|organism=Citrus clementina|type=EST|length=366bp
TAATGGACCGAAATCGGAGTATTACAAGAAAAATGCAGTGGAATTGAAGT
ATGCGGCAAGGCAGGCGGTGGCCGGAGGCGGTTCGTCGGACCAGAATATT
CAGTTGTTTGCTGATGAGATTCTTGGAAATTATAGTGAACGTGGGGCACG
TTGTGGAGAAAATTTGGCTTCATCAATGATAGGTTAATATTTATTTTCAA
TATTGCTTGATGTAAAATGAAGTCATAAAAGTAGTACTACAAGAATAAAA
AGGTTGATGGTCCAAATAAACAAGTATTGCTACATAGTTCCATTGGCATT
AATCAATAATTATTTGTAATTGCGAGCCATATTTCAACCAGAATTTGATA
AAAAAAAAAAAAAAAA
back to top