CX294971

Overview
NameCX294971
Unique NameCX294971
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length589
Libraries
Library NameType
DroRLeaf1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig4097 contig Ccv1_Contig4097:368..956. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC05065B10SK DroRLeaf1 Citrus clementina cDNA clone C05065B10, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX294971 ID=CX294971|Name=CX294971|organism=Citrus clementina|type=EST|length=589bp
AGGATTTTCCATAAACTCGGTGAGGGAACCAACATGTCAATTGACAGCTT
TAGCAGCTTGCAAACGAGCAACGGCGGAGGTTCTGTTGCGATGTCTGTAG
ATAACAGCAGTGTTGGATCAAATGAATCCCATACTCGCATTTTGAACCAC
CAAGGGTTGCGCCGCCGTGCTAATGATAACTACTCTGTTGCACATAGTGT
GAATCGTCGAGGAAGAGTTTCACATGCTTTAAGTGATGATGCCTTGGCTC
GAGCTCTTATGGATAGCAACTCTCCAACGGAGGGGCTTGAGAATTTTGAT
GAGTGGACTATTGATTTAAGGAAGCTCAACATGGGAGATGCTTTTGCACA
AGGTGCCTTTGGGAAGCTCTATAGAGGAACCTACAACGGTGAGGAGGTGG
CTATCAAGATCTTGGAGAGGCCAGAAAATGATCCAGAAAAAGCACAGGTG
ATGGAGCAGCAATTTCAACAGGAAGTCATGATGCTGGCCACTCTAAAACA
TCCAAACATAGTGCGGTTCATTGGTGCATGCCGTAGCCAATGGTCTGGTG
CATTGTCCTGAATATGCAAAGGAGTCAGTCGGAGTTTTA
back to top