CX308529

Overview
NameCX308529
Unique NameCX308529
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length348
Libraries
Library NameType
AbsLeaSub1cdna_library
Alignments
Feature NameTypeLocationAnalysis
CX308529_ssr82 microsatellite CX308529_ssr82:82..93.
Properties
Property NameValue
Genbank descriptionC21001A03Rv AbsLeaSub1 Citrus clementina cDNA clone C21001A03, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX308529 ID=CX308529|Name=CX308529|organism=Citrus clementina|type=EST|length=348bp
ACGACTGTCCTTAAAGACTCCTCTGATTGCTTGGCCTTGGGGTCTCTCAT
CAATTTGCTTGAAACCACTGCAGCAGAAGGTGAAGAAGAAGAAGAGGAAA
GCTTCTTTGATGATTGAGAAACTGATGATCTTATACTGTTCTTGGCTTGT
TGGTGTAATGATCTGAGTGTGTAGTTCCATCTACAGAACCCTTGATCTTT
CATGGCCTCAACTGCTGCAACACTTGCTGCTACCATCCATGCTCTGCTTG
TTGAACTCATTCTTAATTTTCTATATATTCTTCAGACGCCCTTCTCTCTT
TTGCTCTTTGTAAGCTCTTGTTAAAGATCTGCTTTTGCTTTGATCCCG
back to top