CX308530

Overview
NameCX308530
Unique NameCX308530
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length501
Libraries
Library NameType
AbsLeaSub1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig942 contig Ccv1_Contig942:1..501. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC21001A04Rv AbsLeaSub1 Citrus clementina cDNA clone C21001A04, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX308530 ID=CX308530|Name=CX308530|organism=Citrus clementina|type=EST|length=501bp
AACGTTTTGATCCAAGCTGGAGGCTCAGCTAATTCTGTGTGCCACCATTA
CTCAATACATAATGTGTCTTTATACTCCCTTAATTTACGAATAAGATACA
GAATCCATGTATCAGTCCCCAAATGTTCACATTGGTCTATGTGGGCCATT
GATGGAACTTGCAACAGCATCGGCTAAAACTATGGTGAAGCTGGGGTCTT
TAGTTAAGGATGCCACATATTCTTAAGTTACGAATAAGATACAGAATCCA
TGTATCAGTCCCCAAATGTTCACATTGGTCTATGTGGGGGACCATTGATG
GAACTTGCAACAGCATCGGCTACAGCTATGGTGAAGCTGGGATCTTTAGT
TAAGGATGCCACATATTCTTCAATCTTCTTTTTATCGTCACAGACTTGCA
TCGGGTTTCTAGGGGGTCTAGTTTCTTGATTGGACCCAGATAGAGTAAGA
TCAAGTGTGACATCTGATCCAAAAGAATCAGTTGTTTGATAATCTGGGCA
A
back to top