CX308532

Overview
NameCX308532
Unique NameCX308532
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length341
Libraries
Library NameType
AbsLeaSub1cdna_library
Properties
Property NameValue
Genbank descriptionC21001A07Rv AbsLeaSub1 Citrus clementina cDNA clone C21001A07, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX308532 ID=CX308532|Name=CX308532|organism=Citrus clementina|type=EST|length=341bp
TATCATTAATCACTTTAAATTTGCAAACCTTCTACAACAAAAAGAACAAA
AGGTATAAATCCATACGCCATCATACAATCTTCTAAAACCATGTATATAT
GAGTTAGCTAGCCGAAAGGCAGCATCATATGAGCAAAATCTCATTGAATT
CTCATGTCTCTTCAGCATATGCTCCGACCAGCTCCTCAATTCACCACCCT
CCTGCATGCAATCACTATGCACACACCATAGTGACTGTGTGCACTCAAGC
TTTCGCGTGCATCTAAAAACCTTGGTGCACTTTCTTTATTTATTCTAACA
ACTACATCTTTTAAAATTATAATAATATATAGAAGCAAATT
back to top