CX308535

Overview
NameCX308535
Unique NameCX308535
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length651
Libraries
Library NameType
AbsLeaSub1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC21001A10Rv AbsLeaSub1 Citrus clementina cDNA clone C21001A10, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX308535 ID=CX308535|Name=CX308535|organism=Citrus clementina|type=EST|length=651bp
TAATTACCTCGGTCATCGAAGATATTACATTTTTTGGGGCTGACTGAGGA
ATTCATACACGATTCTTGCAACATTTACAGCCATCTGGCAGAACAAATAC
ATGAGTTTCATCAATATAGAAAAACATGGCTCCAGATTTTGCCATCTTAT
GTGATTAATCCTGTATGTAATACTAGTGATGGACTTTCACTGCATGTGCC
TCCGTCTTCTTTCCACTTGTCATTCTTTGAGAGTTTCTTCATGCCCAAGT
GATTCACATATGTTTTAATTTGTAGTATTTGGTTTAATATGGACCCCAAG
AACTCAAGTAAATGACTTTTCTCATGGACTCCTCTGATTGCTTTGCTTTC
TCTTCTCTCACTTTATTGTTACTTGAAACCAAAGCAGAGGATGAAGTTGA
AAGCTTCTTGGCTTGAGAGACTGATCTGAGACTGTTCTTGGCATGTTGGT
GTATTAATCTAATGGGGTAGTTCCATCTGCAGAATCCTTGATCCTTCAAA
ACCTCCACTGCTGCAACACTTGCTGCTACCATCCAAGCTCTGCTCGTCGA
ACTCATCTTCTTCCAATTTCTATTGAGATAACAAATTAAATGGCTCTTTT
CTTGAAGATACGAGTGATTAATTAGAATTTTTCTTTTTGATGAAATCCCC
G
back to top