CX308536

Overview
NameCX308536
Unique NameCX308536
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length349
Libraries
Library NameType
AbsLeaSub1cdna_library
Alignments
Feature NameTypeLocationAnalysis
CX308536_ssr82 microsatellite CX308536_ssr82:82..93.
Properties
Property NameValue
Genbank descriptionC21001A11Rv AbsLeaSub1 Citrus clementina cDNA clone C21001A11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX308536 ID=CX308536|Name=CX308536|organism=Citrus clementina|type=EST|length=349bp
ACGACTGTCCTTAAAGACTCCTCTGATTGCTTGGCCTTGGGGTCTCTCAT
CAATTTGCTTGAAACCACTGCAGCAGAAGATGAAGAAGAAGAAGAGGAAA
GCTTCTTTGATGATTGAGAAACTGATGATCTTATACTGTTCTTGGCTTGT
TGGTGTAATGATCTGAGTGTGTAGTTCCATCTACAGAACCCTTGATCTTT
CATGGCCCCAACTGCTGCAACACTTGCTGCTACCATCCATGCTCTGCTTG
TTGAACTCATTCTTAATTTTCTATATATTCTTCAGATGCCCTTCTCTCTT
TTGCTCTTTGTAAGCTCTTGTTAAAGATCTGCTTTTGCTTTGATCCCCG
back to top