CX308537

Overview
NameCX308537
Unique NameCX308537
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length424
Libraries
Library NameType
AbsLeaSub1cdna_library
Alignments
Feature NameTypeLocationAnalysis
CX308537_ssr41 microsatellite CX308537_ssr41:41..52.
Ccv1_Contig943 contig Ccv1_Contig943:17..440. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionC21001A12Rv AbsLeaSub1 Citrus clementina cDNA clone C21001A12, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX308537 ID=CX308537|Name=CX308537|organism=Citrus clementina|type=EST|length=424bp
TTTTTTTTTTTTTTTTTTTTTTTTGTCACACACAGTAACTTTTATTTATT
TATTTTCCTTTTAAGGAAATCATTTTGTAAATAAAGAAAACCTCTTTTAC
ATATGAAGAGATCTTATAAGCTGAATTGAACCGAGCTAAGATACTAACAT
GATTGATAGGTAACAATATACCTATCATTTATTTAATTAAACATAACATT
AAAAAATATCACTACACTTAACCCATACGGTCGGGGTTTCTCCCATATTG
AGGGACAACAAGAAGATCAAGGTTGTCATTCACCATATCATCATCAGCAA
TACTGTGCCACGGCTGGACGTTCACAGTCTCCGACCACTTATTACCTGCA
CAGGTAGTTTCCATGTTCACACAGAAAGATCTCTGCTTACGGGGAAGAAA
GCTCAAAAGTAATTAAGTTCCCCG
back to top