CX308538

Overview
NameCX308538
Unique NameCX308538
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length293
Libraries
Library NameType
AbsLeaSub1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig7863 contig Ccv1_Contig7863:298..590. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC21001B01Rv AbsLeaSub1 Citrus clementina cDNA clone C21001B01, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX308538 ID=CX308538|Name=CX308538|organism=Citrus clementina|type=EST|length=293bp
GGTCGGCCCCTCCCCGTTCAGCTATCGGCTCGTCGGCCGAACCGACCGTC
TTAGTTGGTTGGTTATTTCTGGTTCTGTTATAGTCATCGTTTAGTCTCGA
AACTCTCTTTCTAATTTTTTTTTTTATGTTATTTTTTATTTTGCGAAATT
CATAGTGTTGTAATTAATTATAAATTTGGTGCCGATACTTGAAGAGAGAC
AAGTGATTAGTAGGTGTTAATTGTAATGACATTACTCTTCGTATATACAA
GGAGAAGAGATTATCATCTAAAAAAAAAAAAAAAAAAAAAAAA
back to top